ID: 1091558695_1091558716

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1091558695 1091558716
Species Human (GRCh38) Human (GRCh38)
Location 12:1594483-1594505 12:1594523-1594545
Sequence CCGCGGGCCGGCGGGCGGCGAGG CGCACGGGCTCCGGGCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 47, 4: 363} {0: 1, 1: 0, 2: 1, 3: 23, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!