ID: 1091801261_1091801274

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091801261 1091801274
Species Human (GRCh38) Human (GRCh38)
Location 12:3326194-3326216 12:3326237-3326259
Sequence CCCTGCAGGCCCATCCGTGTCTG GAATTTTTTATGAAGTTCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!