|
Left Crispr |
Right Crispr |
| Crispr ID |
1092093817 |
1092093823 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:5825338-5825360
|
12:5825380-5825402
|
| Sequence |
CCATGTATGCTCTGAATCACCAT |
CTCCCATAGCCAGGATTCACGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 74, 2: 98, 3: 99, 4: 184} |
{0: 125, 1: 202, 2: 185, 3: 155, 4: 259} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|