ID: 1092435141_1092435147

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1092435141 1092435147
Species Human (GRCh38) Human (GRCh38)
Location 12:8441479-8441501 12:8441494-8441516
Sequence CCTTGTGATATGGTTTTTAATAT TTTAATATCCAGGGGGCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 31, 3: 27, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!