|
Left Crispr |
Right Crispr |
| Crispr ID |
1092689816 |
1092689824 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:11095541-11095563
|
12:11095578-11095600
|
| Sequence |
CCTTTATTGGCCAGGCAGGGTAG |
CCCAACATTTTGTAAGGCTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 8, 3: 70, 4: 475} |
{0: 4, 1: 46, 2: 1360, 3: 18658, 4: 130003} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|