ID: 1093048920_1093048926

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1093048920 1093048926
Species Human (GRCh38) Human (GRCh38)
Location 12:14484949-14484971 12:14484995-14485017
Sequence CCAAAGCCCAGTTAACAGGCCAA AGTTACCTGCAAAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115} {0: 2, 1: 12, 2: 207, 3: 202, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!