ID: 1093106656_1093106666

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1093106656 1093106666
Species Human (GRCh38) Human (GRCh38)
Location 12:15095415-15095437 12:15095461-15095483
Sequence CCTGCCGGATCCAGAGGGATGGA TGGCAAACAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 10, 1: 60, 2: 121, 3: 156, 4: 192} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!