|
Left Crispr |
Right Crispr |
| Crispr ID |
1093392082 |
1093392086 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:18635523-18635545
|
12:18635562-18635584
|
| Sequence |
CCTAGTAGCAGGTCAAGAGCTAT |
GGTTATCTGCATAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 37, 3: 257, 4: 346} |
{0: 1, 1: 12, 2: 197, 3: 201, 4: 197} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|