ID: 1093561822_1093561834

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1093561822 1093561834
Species Human (GRCh38) Human (GRCh38)
Location 12:20551834-20551856 12:20551886-20551908
Sequence CCTGTGTGGGCCGCACCAAGGAA ACCCATCCCGGGGATCCCCGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 98} {0: 2, 1: 0, 2: 0, 3: 4, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!