ID: 1093561833_1093561841

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1093561833 1093561841
Species Human (GRCh38) Human (GRCh38)
Location 12:20551877-20551899 12:20551900-20551922
Sequence CCACTACGGACCCATCCCGGGGA TCCCCGTGGGCACCATGTGGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 44} {0: 2, 1: 0, 2: 2, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!