ID: 1093578838_1093578846

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1093578838 1093578846
Species Human (GRCh38) Human (GRCh38)
Location 12:20765711-20765733 12:20765743-20765765
Sequence CCATGTCCCATCTGTGTGGGACC ATCGGACTGTTCAACTCACCTGG
Strand - +
Off-target summary No data {0: 315, 1: 324, 2: 125, 3: 60, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!