ID: 1093742584_1093742590

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1093742584 1093742590
Species Human (GRCh38) Human (GRCh38)
Location 12:22705336-22705358 12:22705371-22705393
Sequence CCACCCTAGGGCTAACATGATGA AGTGGTCACGTTAGCAGGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!