ID: 1094041184_1094041197

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1094041184 1094041197
Species Human (GRCh38) Human (GRCh38)
Location 12:26122893-26122915 12:26122940-26122962
Sequence CCGCGCGCTCCAGGCAGGGGGCG GCGCCGGTGCCTTTGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!