ID: 1094212360_1094212367

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1094212360 1094212367
Species Human (GRCh38) Human (GRCh38)
Location 12:27905904-27905926 12:27905946-27905968
Sequence CCTCCTTTCCCATCGTGGCTTGA CTAGTTTTTCAGGTTTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 69, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!