ID: 1094714138_1094714145

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1094714138 1094714145
Species Human (GRCh38) Human (GRCh38)
Location 12:32994873-32994895 12:32994903-32994925
Sequence CCACAGATGACCATACTCATTCC ACCCACTTGGGAATCAGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!