ID: 1094838870_1094838885

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1094838870 1094838885
Species Human (GRCh38) Human (GRCh38)
Location 12:34334727-34334749 12:34334756-34334778
Sequence CCCCCACCAGGCCCCACCTGCCG CGCGGGGTCCCTGGTTCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!