ID: 1094838875_1094838889

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1094838875 1094838889
Species Human (GRCh38) Human (GRCh38)
Location 12:34334738-34334760 12:34334764-34334786
Sequence CCCCACCTGCCGCGCATGCGCGG CCCTGGTTCCCTGGGGTCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 68, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!