ID: 1094839478_1094839490

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1094839478 1094839490
Species Human (GRCh38) Human (GRCh38)
Location 12:34336936-34336958 12:34336974-34336996
Sequence CCCTGCCGCGCATGCGCAGGGTC CGGAGTTGCTGGACACCGCGGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 8, 3: 19, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!