ID: 1094843999_1094844002

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1094843999 1094844002
Species Human (GRCh38) Human (GRCh38)
Location 12:34353535-34353557 12:34353550-34353572
Sequence CCCACGTATGCGCGGTGGGGAGG TGGGGAGGCACTTTCACCTGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 6, 3: 36, 4: 108} {0: 3, 1: 8, 2: 34, 3: 138, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!