ID: 1095267760_1095267768

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1095267760 1095267768
Species Human (GRCh38) Human (GRCh38)
Location 12:40180290-40180312 12:40180324-40180346
Sequence CCCACCAAATTGCCCTTAAAAAC AATGCTCAGAAAGACTGATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 26, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!