|
Left Crispr |
Right Crispr |
| Crispr ID |
1095547449 |
1095547461 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:43388326-43388348
|
12:43388379-43388401
|
| Sequence |
CCTGCCTGCTTCTGTTCACCCTC |
GATGAACTGGGTACCTCAGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 183, 3: 496, 4: 1160} |
{0: 204, 1: 450, 2: 2210, 3: 4147, 4: 1875} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|