|
Left Crispr |
Right Crispr |
| Crispr ID |
1096288710 |
1096288716 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:50322933-50322955
|
12:50322981-50323003
|
| Sequence |
CCTGCCATCTTCTGTAGATAACT |
GGCCTGCTACTGGGCTTTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 197, 2: 196, 3: 113, 4: 220} |
{0: 4, 1: 149, 2: 166, 3: 113, 4: 294} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|