ID: 1096351232_1096351238

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1096351232 1096351238
Species Human (GRCh38) Human (GRCh38)
Location 12:50902825-50902847 12:50902861-50902883
Sequence CCAGAGGAATGGAAGTCAGTGGC CGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary No data {0: 62, 1: 126, 2: 64, 3: 58, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!