|
Left Crispr |
Right Crispr |
| Crispr ID |
1096457463 |
1096457472 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:51799419-51799441
|
12:51799464-51799486
|
| Sequence |
CCAAAGCCCAGTAACAGGCCAAG |
AGTTATCTGCAGAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 169, 1: 171, 2: 103, 3: 76, 4: 232} |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|