|
Left Crispr |
Right Crispr |
Crispr ID |
1096457465 |
1096457473 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:51799426-51799448
|
12:51799465-51799487
|
Sequence |
CCAGTAACAGGCCAAGAGCCGTC |
GTTATCTGCAGAAGATGGCAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 163, 2: 192, 3: 136, 4: 163} |
{0: 180, 1: 172, 2: 120, 3: 86, 4: 284} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|