ID: 1096542523_1096542534

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096542523 1096542534
Species Human (GRCh38) Human (GRCh38)
Location 12:52315979-52316001 12:52316027-52316049
Sequence CCTGATCAGGCAGGCCATGTCTT CAGCTCGGCCAGCTTGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 7, 4: 116} {0: 3, 1: 2, 2: 1, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!