|
Left Crispr |
Right Crispr |
Crispr ID |
1096626429 |
1096626435 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:52898794-52898816
|
12:52898813-52898835
|
Sequence |
CCCGCTGCAGGGCGGCCTCCAGC |
CAGCTCGGACAACTTGGCGTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 16, 2: 20, 3: 49, 4: 391} |
{0: 3, 1: 9, 2: 11, 3: 13, 4: 48} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|