ID: 1096626430_1096626435

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1096626430 1096626435
Species Human (GRCh38) Human (GRCh38)
Location 12:52898795-52898817 12:52898813-52898835
Sequence CCGCTGCAGGGCGGCCTCCAGCT CAGCTCGGACAACTTGGCGTTGG
Strand - +
Off-target summary {0: 12, 1: 14, 2: 7, 3: 33, 4: 301} {0: 3, 1: 9, 2: 11, 3: 13, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!