ID: 1096749707_1096749728

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1096749707 1096749728
Species Human (GRCh38) Human (GRCh38)
Location 12:53751219-53751241 12:53751263-53751285
Sequence CCTCCTCTGAGCCCTGCGGCCCG CTGCAGGGGTTGGGGGCGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!