ID: 1096956636_1096956643

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1096956636 1096956643
Species Human (GRCh38) Human (GRCh38)
Location 12:55532861-55532883 12:55532914-55532936
Sequence CCACTAACCAAGCATCTTCTGTC CACATAAACTGAAGGTAAAGGGG
Strand - +
Off-target summary No data {0: 5, 1: 279, 2: 453, 3: 421, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!