ID: 1097399388_1097399397

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1097399388 1097399397
Species Human (GRCh38) Human (GRCh38)
Location 12:59110508-59110530 12:59110538-59110560
Sequence CCACCGTCCTCCTTCAAGATAAT GACCAAGATGGTGCTACAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!