|
Left Crispr |
Right Crispr |
| Crispr ID |
1097648440 |
1097648446 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:62264121-62264143
|
12:62264154-62264176
|
| Sequence |
CCTGCAGGCACATGCCACCACGC |
TTTTATTTTTAGTAGAGACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 11, 2: 79, 3: 239, 4: 655} |
{0: 1685, 1: 73281, 2: 177738, 3: 211161, 4: 161363} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|