ID: 1097648440_1097648448

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1097648440 1097648448
Species Human (GRCh38) Human (GRCh38)
Location 12:62264121-62264143 12:62264173-62264195
Sequence CCTGCAGGCACATGCCACCACGC AGGGTTTCCCCATGTTACCCGGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 79, 3: 239, 4: 655} {0: 6, 1: 377, 2: 12155, 3: 90171, 4: 236397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!