ID: 1097728277_1097728289

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1097728277 1097728289
Species Human (GRCh38) Human (GRCh38)
Location 12:63099309-63099331 12:63099343-63099365
Sequence CCCTCCCTCTCAACTAAGGTCAG GCTGGGAAGGAAAACAGAAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 8, 3: 99, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!