ID: 1097821340_1097821344

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1097821340 1097821344
Species Human (GRCh38) Human (GRCh38)
Location 12:64131853-64131875 12:64131879-64131901
Sequence CCAGTAACAGGCCAAGAGCTGTC CAAAAGGAGAGTAGTTGGCCAGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} {0: 1, 1: 1, 2: 1, 3: 23, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!