|
Left Crispr |
Right Crispr |
| Crispr ID |
1097843356 |
1097843360 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:64342750-64342772
|
12:64342764-64342786
|
| Sequence |
CCAGTAACAGGCCAAGAGCTGTT |
AGAGCTGTTTCTCAAAAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 182, 2: 215, 3: 166, 4: 215} |
{0: 4, 1: 8, 2: 12, 3: 25, 4: 379} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|