ID: 1098705588_1098705601

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1098705588 1098705601
Species Human (GRCh38) Human (GRCh38)
Location 12:73685039-73685061 12:73685088-73685110
Sequence CCTGCTCACTGAACAGCCGTTGG AGGTACTATATCAAGGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 171, 4: 520} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!