ID: 1099292613_1099292619

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1099292613 1099292619
Species Human (GRCh38) Human (GRCh38)
Location 12:80790072-80790094 12:80790109-80790131
Sequence CCATCCACCACTGCTGTTTTGCC GCCACTGACTTCCATCCCTCTGG
Strand - +
Off-target summary {0: 5, 1: 4, 2: 6, 3: 135, 4: 333} {0: 20, 1: 62, 2: 98, 3: 105, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!