|
Left Crispr |
Right Crispr |
Crispr ID |
1099735783 |
1099735785 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:86565012-86565034
|
12:86565057-86565079
|
Sequence |
CCTACTATCTTCTGCAGATAACT |
CTTGGCCTGTTACTGCGCTTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 19, 2: 211, 3: 205, 4: 269} |
{0: 3, 1: 178, 2: 169, 3: 123, 4: 150} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|