ID: 1100023257_1100023266

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1100023257 1100023266
Species Human (GRCh38) Human (GRCh38)
Location 12:90097149-90097171 12:90097182-90097204
Sequence CCTGGATCATCCAGATGGGTGTT ACAGGTATCCTTCTAAGGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!