ID: 1100142382_1100142396

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1100142382 1100142396
Species Human (GRCh38) Human (GRCh38)
Location 12:91634232-91634254 12:91634273-91634295
Sequence CCCACCCCGCCGTGGGCGCCTGC GATCGCCGCCCCCTGCTCCAGGG
Strand - +
Off-target summary No data {0: 3, 1: 206, 2: 439, 3: 522, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!