|
Left Crispr |
Right Crispr |
| Crispr ID |
1100241151 |
1100241154 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:92711597-92711619
|
12:92711631-92711653
|
| Sequence |
CCAGTAACAGGCCAAGAGCTGTC |
GAGTAGTTATCTGCAGAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 162, 1: 189, 2: 129, 3: 114, 4: 178} |
{0: 178, 1: 192, 2: 102, 3: 110, 4: 247} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|