|
Left Crispr |
Right Crispr |
| Crispr ID |
1100662014 |
1100662023 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:96709834-96709856
|
12:96709875-96709897
|
| Sequence |
CCTCAGCCTCCCAAGTAATTGGG |
CACGCCCAGCTAATTTTTTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 129, 1: 5652, 2: 104835, 3: 216356, 4: 261594} |
{0: 8, 1: 66, 2: 227, 3: 440, 4: 599} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|