ID: 1100662019_1100662023

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1100662019 1100662023
Species Human (GRCh38) Human (GRCh38)
Location 12:96709844-96709866 12:96709875-96709897
Sequence CCAAGTAATTGGGACAATAGGCG CACGCCCAGCTAATTTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 179, 3: 4897, 4: 63889} {0: 8, 1: 66, 2: 227, 3: 440, 4: 599}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!