ID: 1100793122_1100793130

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1100793122 1100793130
Species Human (GRCh38) Human (GRCh38)
Location 12:98152437-98152459 12:98152465-98152487
Sequence CCACCTGTTCCCCACATACCTAT CACAGACTCCTGAAACCTATGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 427, 3: 944, 4: 1200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!