ID: 1100946319_1100946325

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1100946319 1100946325
Species Human (GRCh38) Human (GRCh38)
Location 12:99787943-99787965 12:99787995-99788017
Sequence CCAGAAGGGAATCACCCATGGAA CACTGCAGGCTGAAGTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 200} {0: 3, 1: 25, 2: 70, 3: 191, 4: 765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!