ID: 1101153836_1101153840

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101153836 1101153840
Species Human (GRCh38) Human (GRCh38)
Location 12:101908747-101908769 12:101908779-101908801
Sequence CCAGGGTTCTTTGCTAAAACTGG GGAAGTGCACAGATGGACCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 143} {0: 5, 1: 26, 2: 63, 3: 90, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!