ID: 1101737825_1101737832

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1101737825 1101737832
Species Human (GRCh38) Human (GRCh38)
Location 12:107476163-107476185 12:107476189-107476211
Sequence CCCCGGCTACCTAGGCTGTTCAG CTTGTCTGCCCCTCCTGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 53} {0: 1, 1: 0, 2: 0, 3: 19, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!