ID: 1101737828_1101737842

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1101737828 1101737842
Species Human (GRCh38) Human (GRCh38)
Location 12:107476172-107476194 12:107476225-107476247
Sequence CCTAGGCTGTTCAGCCCCTTGTC AGTGAAATGTCAGATGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 164} {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!