ID: 1101737829_1101737843

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1101737829 1101737843
Species Human (GRCh38) Human (GRCh38)
Location 12:107476186-107476208 12:107476239-107476261
Sequence CCCCTTGTCTGCCCCTCCTGATG TGAGCTGGGAGCTACCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 283} {0: 1, 1: 0, 2: 0, 3: 16, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!